Accumulation of Cyclooxygenase-2 Gene Transcripts: MATERIALS AND METHODS(3)

2 Apr
2013

Detection of Specific Gene Transcripts by RNase Protection Assay (RPA)

Preparation of polymerase chain reaction-amplified cDNA fragments for bovine COX-1 and -2 and the corresponding cRNA probes. The sequence of bovine COX-1 mRNA and COX-2 mRNA had not been described at the time this study was begun. Oligonucleotides suitable for use in PCR assay were therefore designed based on the published guinea pig COX-1 and -2 sequences, which in turn were based on ovine, murine, human, and rat sequences. Regions were chosen that have low homology between isoforms but are highly conserved between species: COX-1 5′-primer— GTGTGACCTGCTGAAGGCTGAGCAC; COX-1 3′ -primer—CTTCGGGTCCCCATTAAAGGCCTCC; COX-2 5′-primer—<TCCCATACCAGG-CAGATGAAATAC; COX-2 3′-primer— CTGTGGGATTGATATCATCTAGTC. buy yasmin online

Numbers in square brackets indicate nucleotide positions relative to the human cDNAs. Using a standard reverse transcrip-tion-polymerase chain reaction (RT-PCR) protocol and Superscript RNase H-reverse transcriptase (Gibco BRL, Life Technologies Inc., Gaithersburg, MD), bovine intercaruncular endometrium from parturient cow uteri was used to program the synthesis of single-stranded cDNAs, and the resulting RT-PCR product was cloned into plasmid vector pGEM-T (Promega, Madison, WI). Double-stranded sequencing was performed using TF Sequencing kit (Phar-macia, Piscataway, NJ). The cDNA fragments of bovine COX-1 and COX-2 genes exhibited 89.0% and 90.2% homologies to the corresponding regions of human COX-1 and -2 (Align; DNASTAR Inc., Madison, WI).

top